|
The objective of this research is to analyze the genetic characterization of a bovine viral diarrhea virus (BVDV) strain (HB-DCZ strain) isolated from China and describe its relationship with other BVDV strains. Special primers (forward: 5′- gagatctcgggaggtac -3′, reverse: 5′- cctctcggcatgatcccgaaa -3′) are used to amplify partial NS2-3 sequence of HB-DCZ strain by reverse transcription polymerase chain reaction (RT-PCR). The product of PCR is cloned into pMD18-T vector, and then transfected into JM109. The recombinant plasmids are extracted and identified by EcoR I and Hind III enzyme digestion. The NS2–3 nucleotide fragment of the isolated virus is sequenced, and then amino acid sequence is deduced. Nucleotide sequence and deduced amino acid sequence of the strain are analyzed and compared with other BVDV strains from Genebank with the aid of DNAstar software. The results show that the obtained fragment of HB-DCZ strain contains 665 bp nucleotides, which indicate that there is no insertion in the isolated virus genome. The homologies of nucleotide sequences show that HB-DCZ strain has 99.1%, 97.4%, 92.3%, 77%, 76.9%, 76.4% and 76.2%, sequence similarity with 184, ZM195, Osloss, Oregon C24V, Singer, NADL, and S D-I, respectively. According to the nucleotide sequences of the obtained fragments, the 208 corresponding amino acids are deduced. The homologies of amino acid sequences show that HB-DCZ strain had 100%, 93.3%, 91.3% and 83.2% sequence similarity with VEDEVAC, Osloss, ILLC and Oregon C24V, respectively. In conclusion, HB-DCZ strain has no exogenous sequence insertion, no gene recombination, no gene rearrangement and no gene deficiency. HB-DCZ strain is closely related to BVDV Osloss strain, and belongs to subtype Ib. |
